| Name | Authority | Name Status |
|---|---|---|
| D4S1542 | HUGO_DNA | Alias |
| AFM189yc3 | Weissenbach, Jean | Primary |
| AFM189yc3m | Weissenbach, Jean | Alias |
| AFM189yc3a | Weissenbach, Jean | Alias |
| AFM189yc3a/AFM189yc3m | Weissenbach, Jean | Alias |
| Chromosome | Left Marker | Right Marker | Map Element ID | Approval Status | Map |
|---|---|---|---|---|---|
| 4 | 4pter | 4qter | GDB:1027689 | Unreviewed | Chromosome - 4 - Cytogenetic Map |
| Chromosome | Map Element ID | Map | Coordinate | Units |
|---|---|---|---|---|
| 4 | GDB:4602486 | RH Consortium Transcript Map - Chromosome 4 | 94.0000 | Kosambi centiMorgans |
| 4 | GDB:4512922 | CHLC Chromosome 4 Recombination Minimization (Male) | 77.2000 | Kosambi centiMorgans |
| 4 | GDB:4512865 | CHLC Chromosome 4 Recombination Minimization (Female) | 155.4000 | Kosambi centiMorgans |
| 4 | GDB:4263442 | CHLC Chromosome 4 Recombination Minimization (Sex Ave) | 114.8000 | Kosambi centiMorgans |
| 4 | GDB:1214740 | Genethon - Chromosome 4 (March 1996) | 99.0000 | Kosambi centiMorgans |
| 4 | GDB:3747246 | CEPH/Genethon Chromosome 4 Linkage Map | 96.0000 | Kosambi centiMorgans |
| 4 | GDB:1109090 | SHGC Chromosome 4 Radiation Hybrid Map (G3) | 3750.0000 | CentiRays |
| Relationship | Marker | Observation | Order ID |
|---|---|---|---|
| Contained In | Bin Bin 106 | Unknown | GDB:1109745 |
| Contained In | Clone 631_c_3 | Amplifies from | GDB:5601794 |
| Contained In | Clone 759_e_5 | Amplifies from | GDB:5601795 |
| Contained In | Clone 768_b_8 | Amplifies from | GDB:5601796 |
| Contained In | Clone 768_c_8 | Amplifies from | GDB:5601797 |
| Contained In | Clone 775_d_1 | Amplifies from | GDB:5601798 |
| Contained In | Clone 859_d_11 | Amplifies from | GDB:5601799 |
| Contained In | Clone 899_c_3 | Amplifies from | GDB:5601800 |
| Contained In | Clone 942_h_3 | Amplifies from | GDB:5601801 |
| Contained In | Clone 957_a_2 | Amplifies from | GDB:5601802 |
| Contained In | Clone 968_a_6 | Amplifies from | GDB:5601803 |
| Overlaps | Clone 631_c_3 | Hybridizes with | GDB:927082 |
| Overlaps | Clone 759_e_5 | Hybridizes with | GDB:927083 |
| Overlaps | Clone 899_c_3 | Hybridizes with | GDB:927084 |
| Overlaps | Clone 957_a_2 | Hybridizes with | GDB:927085 |
| Overlaps | Clone 968_a_6 | Hybridizes with | GDB:927086 |
| Overlaps | Clone 942_h_3 | Hybridizes with | GDB:927087 |
| Polymorphism | Variation Type | Position | Max Het |
|---|---|---|---|
| D4S1542 Dinucleotide Repeat | Dinucleotide Repeat | UNKN | 0.4500 |
| Primer Name | Primer Sequence |
|---|---|
| AFM189yc3a | CTTTTCAAAGATCGACTCCAGTG |
| AFM189yc3m | ATTCTCCCAGATAGCAGGGC |